addgene plasmid (Addgene inc)

Addgene inc is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Addgene inc addgene plasmid
Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 3097 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcmv+vsv+g+addgene/pCMV-VSV-G+(Plasmid+%238454)/pm41915470-258-32-32
Average 96 stars, based on 3097 article reviews

addgene plasmid - by Bioz Stars, 2026-09

96/100 stars

Images

other:

Article Title: ACVR2A attenuation impacts lactate production and hyperglycolytic conditions attracting regulatory T cells in hepatocellular carcinoma
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Millicell -24 Cell Culture Insert Plate Sigma-Aldrich Cat# PSET010 PierceTM BCA Protein Assay Reagent B ThermoFisher Cat# 23224 0.45 mm-membrane filters Merck Millipore Cat# HAWP04700 Deposited data RNA sequencing data of surgically resected liver cancer Pinyol et al. (2021) TCGA: PanCancer Atlas RNA sequencing data of surgically resected HCC Shimada et al. (2019) TMDU dataset RNA sequencing data of Acvr2a NC and KO mouse HCC cells This paper GEO: GSE248922 RNA sequencing data of Acvr2a NC and KO mouse HCC cells This paper Science DB: https://doi.org/ 10.57760/sciencedb.21374 scRNA-seq data Gene Expression Omnibus site GEO: GSE125449, GEO: GSE146115, GEO: GSE149614, GEO: GSE151530, GEO: GSE189903, GEO: GSE242889 Experimental models: Cell lines Human: HepG2 ATCC Cat# HB-8065TM Human: HLF JCRB Cell Bank Cat# JCRB0405 Human: HLE JCRB Cell Bank Cat# JCRB0404 Human: JHH4 JCRB Cell Bank Cat# CVCL_2787 Human: JHH5 JCRB Cell Bank Cat# CVCL_0364 Human: HuH7 JCRB Cell Bank Cat# CVCL_0336 Human: PLC/PRF/5 ATCC Cat# CRL-8024 Human: HEK293T ATCC Cat# CRL-1573 Mouse: Hepa1-6 ATCC Cat# CRL-1830 Mouse: 3H3 Lab preserve N/A Experimental models: Organisms/strains Mouse: KSN/Slc SANKYO LABO N/A Mouse: C57BL/6 SANKYO LABO N/A Recombinant DNA lentiGuide-Puro vector Addgene Cat# 52963 lentiCRISPR v2 vector Addgene Cat# 52961 pCMVDR8.2 Addgene Cat# 12263 pCMV-VSV-G Addgene Cat# 8454 pLV[shRNA]-Hygro-U6>hLDHA [shRNA#1] VectorBuilder Cat# VB900132-3087sgz pLV[shRNA]-Hygro-U6>hLDHA [shRNA#2] VectorBuilder Cat# VB900132-3088hvp pLV[shRNA]-Hygro-U6>mLdha [shRNA#1] VectorBuilder Cat# VB900132-3089gvs pLV[shRNA]-Hygro-U6>mLdha [shRNA#2] VectorBuilder Cat# VB900132-3090mdx pLV[Exp]-Puro-CMV>tTS/rtTA VectorBuilder Cat# VB010000-4479gwh pLV[miR30]-Hygro-TRE>ORF_Stuffer: {hSLC16A3[miR30-shRNA#1]} VectorBuilder Cat# VB220908-1329kuk pLV[miR30]-Hygro-TRE>ORF_Stuffer: {hSLC16A3[miR30-shRNA#2]} VectorBuilder Cat# VB220908-1331umr pLV[miR30]-Hygro-TRE>ORF_Stuffer: {mSLC16A3[miR30-shRNA#1]} VectorBuilder Cat# VB220908-1333zzw pLV[miR30]-Hygro-TRE>ORF_Stuffer: {mSLC16A3[miR30-shRNA#2]} VectorBuilder Cat# VB220908-1336mkz Oligonucleotides Primers for qPCR This paper see Table S3 Software and algorithms Fiji/ImageJ https://imagej.net/Fiji R CRAN https://www.r-project.org/ Python https://www.python.org/ (Continued on next page) Cell Reports Medicine 6, 102038, April 15, 2025 e3 Article ll OPEN ACCESS

Article Title: Selective TLR ligand stimulation enhances in vivo mosquito-borne flavivirus pathogenicity.
Article Snippet: This paper GEO: GSE272689 Experimental models: Cell lines Human: 293T ATCC Cat# CRL-3216 African green monkey: Vero ATCC Cat#CCL-81 Mosquito: C6/36 ATCC Cat# CRL-1660 Human: HEK-Dual Null InvivoGen Cat# hkd-nullni Human: HEK-Dual mTLR4 InvivoGen Cat# hkd-mtlr4ni Human: HEK-Dual hTLR2 This paper N/A Human: HEK-Dual hTLR3 This paper N/A Human: HEK-Dual hTLR5 This paper N/A Human: HEK-Dual hTLR7 This paper N/A Human: HEK-Dual hTLR8 This paper N/A Human: HEK-Dual hTLR9 This paper N/A Experimental models: Organisms/strains C57BL/6J Wild-type SLC Japan Cat#C57BL/6JmsSlc C57BL6 TLR2-/- Oriental Bio Service PRID:IMSR_OBS3 C57BL6 TLR9-/- Oriental Bio Service PRID:IMSR_OBS7 C57BL6 Myd88-/- Oriental Bio Service PRID:IMSR_OBS1 C57BL6 TLR2-/-, TLR4-/-,TLR9-/- Oriental Bio Service PRID:IMSR_OBS21 C57BL6 Casp1-/-,Cacp11-/- This paper N/A IFN-α/βR–γR dKO Phanthanawiboon et al.84 N/A Oligonucleotides Primers for the RT-qPCR, see Table S2 This paper N/A Recombinant DNA Plasmid: pCMV-VSV-G Addgene Cat# 8454 Plasmid: pMDLg/pRRE Addgene Cat# 2251 Plasmid: pRSV-Rev Addgene Cat# 2253 Plasmid: pcDNA3-TLR2-YFP Addgene Cat# 13016 Plasmid: pcDNA3-TLR3-CFP Addgene Cat# 13641 Plasmid: pcDNA3-TLR5-CFP Addgene Cat# 13019 Plasmid: pcDNA3-TLR7-YFP Addgene Cat# 13022 Plasmid: pcDNA3-TLR8-YFP Addgene Cat# 13024 Plasmid: pcDNA3-TLR9-YFP Addgene Cat# 13642 Plasmid: FUIPW lentiviral transfer vector Aizawa et al.85 N/A Plasmid: FUIPW-hsTLR2 This paper N/A Plasmid: FUIPW-hsTLR3 This paper N/A Plasmid: FUIPW-hsTLR5 This paper N/A Plasmid: FUIPW-hsTLR7 This paper N/A Plasmid: FUIPW-hsTLR8 This paper N/A Plasmid: FUIPW-hsTLR9 This paper N/A Software and algorithms Graf PadPrism 8.0 Graph Pad Software https://www.graphpad.com Flowjo LLC https://www.flowjo.com Cytobank Beckman coulter https://premium.cytobank.org/ cytobank 20 Cell Reports 44, 116210, September 23, 2025

Article Title: High fructose promotes MYCN-amplified neuroblastoma progression through NgBR-ACSS2-mediated biosynthesis of acetyl-CoA.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Mouse monoclonal antibody anti-SREBP-1 Santa Cruz Biotechnology Cat# sc-365513; RRID: AB_10843812 List of oligonucleotides used for ChIP assay ChIP-MYCN-forward Integrated DNA Technologies CCTCCTCCTTAACTAGATCCAATG ChIP-MYCN-reverse Integrated DNA Technologies GAACCTGGCCCTGGGATTG ChIP-ACSS2-forward Integrated DNA Technologies CACTCTGGTCACTCCATGG ChIP-ACSS2-reverse Integrated DNA Technologies TGACAAGGGAGAGGGTGGAAC ChIP-GAPDH-forward Integrated DNA Technologies GCCATGTAGACCCCTTGAAGAG ChIP-GAPDH-reverse Integrated DNA Technologies ACTGGTTGAGCACAGGGTACTTTAT ChIP-ACSS2 (no sterol regulatory element)forward Integrated DNA Technologies TCACTAGGGTAAGTGCCCTTC ChIP-ACSS2 (no sterol regulatory element)reverse Integrated DNA Technologies GAGATATTCACTGCACCGAAG Biological samples Neuroblastoma and peripheral nerve tissue array, NB642a Biomax.Us Cat# NB642a Multiple organ tumor tissue array with adjacent normal tissue, MC803b Biomax.Us Cat# MC803b Recombinant DNA Plasmid: lentiCRISPR v2 Addgene Cat# 52961 pCMV-VSV-G Addgene Cat# 8454 psPAX2 Addgene Cat# 12260 Plasmid: pCDNA3-GFP Addgene Cat# 74165 Plasmid: CRISPR-NgBR This manuscript NA Plasmid: CRISPR-ACSS2 This manuscript NA Plasmid: lentishMYCN Sigma Aldrich Cat# TRCN0000042524 Plasmid: PCDNA3.0-ACSS2 Zhimin Liu’s laboratory, The University of Texas MD Anderson Cancer Center NA Plasmid: PCDNA3.0-ACSS2-T363K This manuscript NA Plasmid: PCDNA3.0-Akt K14,20Q This manuscript NA Plasmid: PCDNA3.0-Akt K14,20R This manuscript NA Critical commercial assays Puromycin Thermofisher Scientific Cat# A1113803 DAPI Sigma Aldrich Cat# D9542 Fatostatin (hydrobromide) Cayman Chemical Cat# 13562 U0126 Cell Signal Technology Cat# 9903 Pan-Akt inhibitor: GSK690693 Selleckchem Cat# S1113 ACSS2 inhibitor Selleckchem Cat# S8588 Sodium pyruvate Sigma Aldrich Cat# 113-24-6 Sodium citrate Sigma Aldrich Cat# 6132-04-3 Sodium acetate Sigma Aldrich Cat# 127-09-3 Sodium palmitate Sigma Aldrich Cat# 408-35-5 Duolink® In Situ Detection Reagents Red Sigma Aldrich Cat# DUO92008 Duolink® In Situ PLA® Probe Anti-Rabbit PLUS Sigma Aldrich Cat# DUO92002 Duolink® In Situ PLA® Probe Anti-Mouse MINUS Sigma Aldrich Cat# DUO92004 Cell Counting Kit 8 (WST-8 / CCK8) Abcam Cat# ab228554 BrdU Cell Proliferation Assay Kit Abcam Cat# ab287841 (Continued on next page) 20 Cell Reports 44, 115947, July 22, 2025

Article Title: Pathogenic phosphorylation of linear ubiquitin machinery causes inflammasome sensor degradation.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Plasmid: pcDNA3.1-HA-hHOIL-1L (C460S) This study N/A Plasmid: pcDNA3.1-HA-mHOIL-1L This study N/A Plasmid: pcDNA3.1-HA-mHOIL-1L (T113A) This study N/A Plasmid: pcDNA6A Invitrogen Cat# V221-20 Plasmid: pcDNA6A-PknG This study N/A Plasmid: pcDNA6A-hHOIP This study N/A Plasmid: pcDNA6A-mHOIP This study N/A Plasmid: pcDNA6A-hSHARPIN This study N/A Plasmid: pcDNA3.1-Ub Dr. F. Shao N/A Plasmid: p3×Flag-CMV14 Sigma-Aldrich Cat# E7908 Plasmid: p3×Flag-CMV14-hHOIP This study N/A Plasmid: p3×Flag-CMV14-ASC This study N/A Plasmid: pGEX-6P-1 GE Healthcare Cat# 28-9546-48 Plasmid: pGEX-6P-1-PknG Wang et al. 33 N/A Plasmid: pGEX-6P-1-PknG (NT) This study N/A Plasmid: pGEX-6P-1-PknG (Rdx) This study N/A Plasmid: pGEX-6P-1-PknG (Kinase) This study N/A Plasmid: pGEX-6P-1-PknG (TPR) Ge et al. 34 N/A Plasmid: pGEX-6P-1-PknG (CT) Ge et al. 34 N/A Plasmid: pGEX-6P-1-PknG (ΔRdx) This study N/A Plasmid: pGEX-6P-1-PknG (K181M) Wang et al. 33 N/A Plasmid: pGEX-6P-1-PknG (E190A) This study N/A Plasmid: pGEX-6P-1-hSHARPIN (UBL) This study N/A Plasmid: pGEX-6P-1-hHOIL-1L This study N/A Plasmid: pGEX-6P-1-hHOIL-1L (NT) This study N/A Plasmid: pGEX-6P-1-hHOIL-1L (UBL) This study N/A Plasmid: pGEX-6P-1-hHOIL-1L (NZF) This study N/A Plasmid: pGEX-6P-1-hHOIL-1L (RBR) This study N/A Plasmid: pGEX-6P-1-mHOIL-1L This study N/A Plasmid: pGEX-6P-1-UbcH5c Wang et al. 33 N/A Plasmid: pGEX-6P-1-UbcH7 Wang et al. 33 N/A Plasmid: pGEX-6P-1-OTULIN This study N/A Plasmid: pGEX-6P-1-OTUB1 This study N/A Plasmid: pET28a Novagen Cat# 69864-3 Plasmid: pET28a-SUMO-USP21 (196–565) This study N/A Plasmid: pET30a Novagen Cat# 69909-3 Plasmid: pET30a-PknG Wang et al. 33 N/A Plasmid: pET30a-UBA1 Wang et al. 33 N/A Plasmid: pET30a-Ub Wang et al. 33 N/A Plasmid: pMSCVpuro Clontech Cat# PT3303-5 Plasmid: pMSCV-hHOIL-1L This study N/A Plasmid: pMSCV-hHOIL-1L (T113A) This study N/A Plasmid: pMSCV-hHOIL-1L (C460S) This study N/A Plasmid: pMSCV-mHOIL-1L This study N/A Plasmid: pMSCV-mHOIL-1L (C458S) This study N/A Plasmid: pMSCV-3Flag-3HA-PknG This study N/A Plasmid: pSpCas9(BB)-2A-GFP Addgene Cat# 48138 Plasmid: pCMV-VSV-G Addgene Cat# 8454 Plasmid: pCL-Eco Addgene Cat# 12371 (Continued on next page) 22 Cell Reports 44, 116286, September 23, 2025

Recombinant:

Article Title: Cadherin-1-mediated communication at the leader-follower boundary controls mouse breast tumor organoid collective migration.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant DNA pCMV deltaR8.2 Addgene Cat# 79047 pCMV-VSV-G Addgene Cat# 8454 Software and algorithms Partek Flow software Partek https://www.partek.com/ R The R Project https://www.r-project.org/ FIJI Distribution of ImageJ https://imagej.net/software/fiji/downloads Seurat (v5.0.0) Satijalab https://satijalab.org/seurat/ NIS-Elements Imaging Nikon https://www.microscope.healthcare.nikon. com/products/software/nis-elements GraphPad Prism GraphPad Software Inc https://www.graphpad.com/scientific- software/prism/ MATLAB Mathworks https://www.mathworks.com/products/ matlab.html PIVLab PIVLab https://www.pivlab.de/ AutoCAD Autodesk https://www.autodesk.com/products/ autocad/overview COMSOL COMSOL https://www.comsol.com/ CompuCell3D software CompuCell3D https://compucell3d.org/ CurveAlign/CT-Fire Laboratory for Optical and Computational Instrumentation CurveAlign (https://loci.wisc.edu/ curvealign/) CT-Fire (https://loci.wisc.edu/ctfire/) Other EasySep Streptavidin RapidSpheres STEMCell Cat# 50001 Sylgard 184 elastomer + curing agent Fisher Scientific Cat# 1508840 Fluosphere Polystyrene Beads (1μM, 580/ 605) Invitrogen Cat# F13083 18 Cell Reports 44, 116631, December 23, 2025 ..

Article Title: Adenine base editing with engineered virus-like particles rescues the CFTR mutation G542X in patient-derived intestinal organoids.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains NEB 5-alpha chemically competent E. coli NEB Cat#C2987H Biological samples Patient-derived intestinal organoids Institut Necker Enfants Malades, Paris, France Azienda Ospedaliera di Verona, Verona, Italy N/A Chemicals, peptides, and recombinant proteins DMEM/F12 Gibco Cat#11580546 Glutamax Gibco Cat#35050061 Y-27632 Selleck Chemicals Cat#S6390 A83-01 Tocris Cat#2939 SB431542 Tocris Cat#1614 SB202190 Sigma Cat#S7067 GSK3 inhibitor Stemcell Technologies Cat#72054 Matrigel Corning Cat#356255 TrypLE Thermo Fisher Cat#12605010 jetPRIME transfection reagent Polyplus Cat#101000001 PEG-it Virus Precipitation Solution System Biosciences Cat#LV825A-1 Forskolin Sigma Cat#F3917 Critical commercial assays QIAmp Viral RNA Mini Kit QIAGEN Cat#52904 DNeasy Blood & Tissue Kit QIAGEN Cat#69504 Monarch Total RNA Miniprep Kit NEB Cat#T2010S PlasmidPlus Midi Kit QIAGEN Cat#12941 PlasmidPlus Maxi Kit QIAGEN Cat#12963 LunaScript RT SuperMix Kit NEB Cat#E3010S LightCycler 480 SYBR Green I Master Roche Cat#04707516001 Q5 High-Fidelity 2X Master Mix NEB Cat#M0492L Experimental models: Cell lines Gesicle Producer 293T cells Takara Bio Cat#632617 Oligonucleotides sgRNA G542X: ACCTTCTCAAAGAACTATATGT TTAAGAGCTATGCTGGAAACAG CATAGCAAGTTTAAATAAGGCT AGTCCGTTATCAACTTGAAAAA GTGGCACCGAGTCGGTGCTTTTTTT IDT custom designed Primers qPCR BE-eVLPs fw/rv: TGCTGGAAACAGCATAGCAAGTTT / GACTCGGTGCCACTTTTTCAAGTT Eurofins Genomics custom designed (Continued on next page) e1 iScience 28, 111979, March 21, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Primers amplification CFTR exon 12 with illumina adapters, fw/rv: ACACTCTTTCCCTACACGACGC TCTTCCGATCTGAAGGAAGATGTGCCTTTCA / GACTGGAGTTCAGACGTGTGCT CTTCCGATCTGGCACAGATTCTGAGTAACC Eurofins Genomics custom designed Primers amplification CFTR exon 12 cDNA fw/rv: GGCACCATTAAAGAAAATATCATCTT / CAAATCAGCATCTTTGTATACTG Eurofins Genomics Ramalho et al.53 Primers amplification ADAMTS6 off-target site fw/rv: TTCCTGACCAAGGCTGCTTA / ATCCAGCAAACTAGCATACCA Eurofins Genomics custom designed Recombinant plasmid DNA pCMV-MMLVgag-3xNES-ABE8e-NG Addgene Cat#181754 pBS-CMV-gagpol Addgene Cat#35614 pCMV-VSV-G Addgene Cat8454 pU6-G542X-sgRNA-HEAT IDT custom designed Software and algorithms Image J Schindelin et al.54 https://imagej.net/software/fiji/#publication GraphPad Prism version 10 GraphPad Software, Boston, Massachusetts USA https://www.graphpad.com/features CRISPOR Concordet et al.34 http://crispor.tefor.net/ CRISPResso2 Clement et al.31 http://crispresso2.pinellolab.org/submission Geneious Prime N/A https://www.geneious.com Biorender N/A https://www.biorender.com/ ..

Software:

Article Title: RIPK1 senses S-adenosylmethionine scarcity to drive cell death and inflammation.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pLenti-Flag-mRIPK1-DD This paper N/A pLenti-Flag-mTNFR1-DD This paper N/A pLenti-Flag-mFADD-DD This paper N/A pLenti-HA-mRIPK1 This paper N/A pLenti-HA-mRIPK1-R606K This paper N/A pLenti-HA-mRIPK1-R606A This paper N/A pLenti-HA-mRIPK1-E605A This paper N/A pLenti-HA-PRMT (1-9) This paper N/A pLKO.1-puro-shmPRMT (1-9) This paper N/A pMSCV-hygro-mRIPK1-R606A This paper N/A pMSCV-hygro-mRIPK1-E605A This paper N/A pMSCV-hygro-mRIPK1-R606K This paper N/A pMSCV-hygro-mRIPK1-S321A This paper N/A pMSCV-hygro-NC This paper N/A pET28a-6×His-MBP-mRIPK1-DD This paper N/A pET28a-6×His-MBP-mRIPK1-DD-R606K This paper N/A Gag/Pol Addgene Cat#14887 pCMV-VSV-G Addgene Cat#8454 Lenti-CRISPR v2-Puromycin Addgene Cat#52961 pMD2.G Addgene Cat#12259 psPAX2 Addgene Cat#12260 pLKO.1 Addgene Cat#158646 Software and algorithms ImageJ NIH https://imagej.nih.gov/ij/ Adobe Illustrator CS4 Adobe http://www.adobe.com/ GraphPad Prism GraphPad Software http://www.graphpad.com/ BioRender Website https://www.biorender.com/ Hisat2 Johns Hopkins University https://daehwankimlab.github.io/hisat2/ FeatureCounts WEHI (Walter and Eliza Hall Institute) http://subread.sourceforge.net/ CryoSPARC Structura Biotechnology Inc. https://cryosparc.com/ Skyline MacCoss Lab Software https://skyline.gs.washington.edu/ labkey/project/home/software/ Skyline/begin.view e4 Cell Metabolism 37, 1–18.e1–e9, August 5, 2025 C57BL/6J mice to produce heterozygous Ripk1 WT/R606K mutant progenies, which were then backcrossed with C57BL/6J mice. .. REAGENT or RESOURCE SOURCE IDENTIFIER pLenti-Flag-mRIPK1-DD This paper N/A pLenti-Flag-mTNFR1-DD This paper N/A pLenti-Flag-mFADD-DD This paper N/A pLenti-HA-mRIPK1 This paper N/A pLenti-HA-mRIPK1-R606K This paper N/A pLenti-HA-mRIPK1-R606A This paper N/A pLenti-HA-mRIPK1-E605A This paper N/A pLenti-HA-PRMT (1-9) This paper N/A pLKO.1-puro-shmPRMT (1-9) This paper N/A pMSCV-hygro-mRIPK1-R606A This paper N/A pMSCV-hygro-mRIPK1-E605A This paper N/A pMSCV-hygro-mRIPK1-R606K This paper N/A pMSCV-hygro-mRIPK1-S321A This paper N/A pMSCV-hygro-NC This paper N/A pET28a-6×His-MBP-mRIPK1-DD This paper N/A pET28a-6×His-MBP-mRIPK1-DD-R606K This paper N/A Gag/Pol Addgene Cat#14887 pCMV-VSV-G Addgene Cat#8454 Lenti-CRISPR v2-Puromycin Addgene Cat#52961 pMD2.G Addgene Cat#12259 psPAX2 Addgene Cat#12260 pLKO.1 Addgene Cat#158646 Software and algorithms ImageJ NIH https://imagej.nih.gov/ij/ Adobe Illustrator CS4 Adobe http://www.adobe.com/ GraphPad Prism GraphPad Software http://www.graphpad.com/ BioRender Website https://www.biorender.com/ Hisat2 Johns Hopkins University https://daehwankimlab.github.io/hisat2/ FeatureCounts WEHI (Walter and Eliza Hall Institute) http://subread.sourceforge.net/ CryoSPARC Structura Biotechnology Inc. https://cryosparc.com/ Skyline MacCoss Lab Software https://skyline.gs.washington.edu/ labkey/project/home/software/ Skyline/begin.view e4 Cell Metabolism 37, 1–18.e1–e9, August 5, 2025 C57BL/6J mice to produce heterozygous Ripk1 WT/R606K mutant progenies, which were then backcrossed with C57BL/6J mice. ..

Review

addgene plasmid (Addgene inc)

Structured Review

Images

Related Articles

other:

Recombinant:

Software:

Imaging:

Targeted Proteomics:

Mutagenesis:

Amplification:

Plasmid Preparation:

Similar Products

Image Search Results